CG Am G Wes nasipe kudu koyo ngene Dm A G nduwe bojo kok ra tau ngepenakke Em A Dm - A seneng muring omongane sengak.. F G C kudu tak trimo bojoku pancen galak.. C G Am G Saben dino rasane ra karuan.. Dm ngrasakke bojoku A G sing ra tau perhatian Em nanging piye maneh A Dm atiku wes kadung tresno F senadyan batinku G C ngempet ono jero dodo..
album Simplified info_outline Major & minor chords only visibility 123 album Advanced info_outline Includes 6,7,aug,hdim7 chords visibility 123 album Bass info_outline Advance chords for bass visibility 123 album Edited info_outline All Edited versions visibility 123 album Chords Notes info_outline Notes in chords visibility 123 album Simple Notes info_outline Rhythm of the song visibility 123 album Bass Notes info_outline Sheet music of bass visibility 123 album Music Notes info_outline Sequence of instrument notes visibility 123 close aspect_ratio arrow_drop_down Show all diagrams layers Edit Lyrics cloud_done Save cancel Cancel Edit delete_forever Delete this Version 3/4Time Signature arrow_back0SHIFT arrow_forward BPM doneclose CCCCCCAmCCCCCCCCCFmCCCCCmCCCDCCCCmCCCCCCCGCCCCCCCACCCCCCCDCCCCCCCCmCCCCCCCCGCCCCCCCACCCCCCCDCCCCCCCCmCCCCCCCGCCCCCCCACCCCCCCDCCCCCCCCmCCCCCCCGCCCCCCCACCCCCCCDCCCCCCFCCCCCCmCCGCCCCCCCACCCCCCCDCCCCCCCCmCCCCCCCGCCCCCCCACCCCCCCDCCCCCCCCmCCCCCCCGCCCCCCCACCCCCCCDCCCCCCCCmCCCCCCCGCCCCCCCACCCCCCCDCCCCCCCCmCCCCCCCGCCCCCCCACCCCCCCDCCCCCCCCCCCCCCCGCCCCCCCACCCCCCCDCCCCCCCCCCCCCCCGCCCCCCCACCCCCCCDCCCCCCCCmCCCCCCCGCCCCCCCACCCCCCCDCCCCCCFCCCCCmCCCGCCCCCCCACCCCCCCDCCCCCCCCmCCCCCCCGCCCCCCCACCCCCCCDCCCCCCCCmCCCCCCCGCCCCCCCACCCCCCCDCCCCCCCCmCCCCCCCGCCCCCCCACCCCCCCDCCCCCCCCmCCCCCCCGCCCCCCCACCCCFCCDCCCCCCCCCCCCCCCGCCCCCCCACCCCCCCDCCCCCCCCCCCCCCCGCCCCCCCACCCCCCCDCCCCCCCCCCFCCCCGCCCCCCCACCCCCCCFCCCCCCCCCCCCmCCCGCCCCCCCACCCCCCCDCCCCCCCCmCCCCCCCGCCCCCCCACCCCCCCDCCCCCCCCmCCCCCCCGCCCCCCCACCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCN Private lock Publiclanguage file_download PDF & Tabs music_note Download Midi clear ChordU Learn Any Instrument ChordU has always been about simplicity and ease of access. We are constantly improving our accuracy through research and development. We hope you have a wonderful experience with us. Hello Again !! Please login to your ChordU account. mail Login with Email Forgot Password? Don't have an account? Sign Up trending_flat clearsecurity Forgot Password No worries, enter your registered email to reset your password keyboard_backspace Back to Login
ChordGitar Nella Kharisma - Bidadari Kesleo dan Liriknya [Intro] G Em C D G Em Untumu.. ono kawate C D Ono lomboke, ono kangkunge G Em Yen mrenges.. ketok aslimu C D Ketok wagumu.. ketok mrongosmu [Reff] G Bidadari keseleo G mekso-mekso banget Em nganggo kawat abang ijo
Lirik Lagu Bidadari Keseleo - Via Vallen, Lengkap dengan Chord Kunci Gitar Intro D Bm G A D Bmuntumu ono kawate G Aono lomboke ono kangkunge D Bmyen mrebges ketok aslimu G Aketok wagumu ketok mrongosmu Dbidadari kesleo Dmekso - mekso banget Bmnganggo kawat abang ijo Bmpupure mendok mirok Gkaton kandel separo Gdowo untune koyo sungai Abengawan solo - solo Dbidadari kesleo Dngempet - ngempet banget Bmdadi pingin duwe bojo Bmopo mungkin samar Gyen ora keduman jodoh Glan opo mungkin amung arepApengen mlekoto koto D Bmsing tenang ben iso mikir G Ara usah sumelang ojo kuwatir D Bmsing penting lurus mlakumu G Anganteng atimu nganteng sifatmu Reff Daku ra peduliDsenajan elek rupakuBmakeh uwong ngomongBmuntuku rodo metuGora bakal taj gubrisG Ajare mbokdeku aku manis Ayen jarene bapak aku iki rodo mbois Dtimbangane nyacatD Bmopo wos ayu rupamu untuku tak kawatBmra jalok duek embokmuGsing penting ra bejatGkoyo kelakuanmuAwis kono ndang minggatAsenep ku ndelok rupamu D Bm untumu ono kawate G Aono lomboke ono kangkunge D Bmyen mrebges ketok aslimu G Aketok wagumu ketok mrongosmu Dbidadari kesleo Dmekso - mekso banget Bmnganggo kawat abang ijo Bmpupure mendok mirok Gkaton kandel separo Gdowo untune koyo sungaiAbengawan solo - solo D bidadari kesleo Dngempet - ngempet bangetAdadi pingin duwe bojo Dopo mungkin samar Bmyen ora keduman jodoh Bmlan opo mungkin amung arep Gpengen mlekoto koto D Bmsing tenang ben iso mikir G Ara usah sumelang ojo kuwatir D Bmsing penting lurus mlakumu G Anganteng atimu nganteng sifatmu
Selainlagu Kanggo Kowe ada juga lagu lainnya dari Via Vallen yaitu Bidadari Kesleo, Kuburan Mantan, Emong, dan lainnya. Download lagu Via Vallen Kanggo Kowe koplo mp3 dan chord gitar tidak kami sediakan di blog Lirik Lagu Via Vallen, kami hanya menyediakan Lirik Lagu Via Vallen - Kanggo Kowe dan Artinya.
Lirik Dan Chord Lagu Via Vallen - Bidadari Kesleo INTRO G Em C D G Em Untumu.. ono kawate C D Ono lomboke, ono kangkunge G Em Yen mrenges.. ketok aslimu C D Ketok wagumu.. ketok mrongosmu G Bidadari keseleo G mekso-mekso banget Em nganggo kawat abang ijo Em Pupure medok mirok C katon kandel separo C Dowo untune koyo sungai D bengawan solo, solo G Bidadari kesleo G ngempet ngempet banget Em dadi pengen nduwe bojo Em Opo mungkin samar C yen ora keduman jodoh C Lan opo mungkin amung arep D pengen mlekoto, koto G Em Sing tenang.. ben iso mikir C D Ra usah sumelang.. ojo kuwatir.. G Em Sing penting.. lurus mlakumu C D Ayu atimu.. Ayu sifatmu.. *Kembali ke atas
Lirik"Bidadari Keseleo" dari Via Vallen ini dipublikasikan pada tanggal 4 September 2017 (5 tahun yang lalu).Single ini didistribusikan oleh label Mega Records. Sebelumnya, lagu ini pernah dibawakan oleh Sukir Genk. Berikut cuplikan syair nyanyian / teks dari lagunya: "untumu ono kawate ono lomboke, ono kangkunge yen mrenges ketok aslimu ketok wagumu, ketok mrongosmu bidadari keseleo mekso
album Simplified info_outline Major & minor chords only visibility 123 album Advanced info_outline Includes 6,7,aug,hdim7 chords visibility 123 album Bass info_outline Advance chords for bass visibility 123 album Edited info_outline All Edited versions visibility 123 album Chords Notes info_outline Notes in chords visibility 123 album Simple Notes info_outline Rhythm of the song visibility 123 album Bass Notes info_outline Sheet music of bass visibility 123 album Music Notes info_outline Sequence of instrument notes visibility 123 close aspect_ratio arrow_drop_down Show all diagrams layers Edit Lyrics cloud_done Save cancel Cancel Edit delete_forever Delete this Version 3/4Time Signature arrow_back0SHIFT arrow_forward BPM doneclose CCCCCCCDCCCCCCCCmCCCCCCGCCDCGCCCAmCCCCCFmCDCCCCCCCCCCCCCCCGCCCCCCCACCCAmCCCDCCCCCACCmCCCCCCCGCCCCCCCACCCCCCCDCCCCCCCCCCCCCCCGCCCCCCCDCCCCCCCCCCCCCCCCCCCCCCCGCCCCCCCCCCCACCCDCCCCCCCCCCCCCCCGmCCCCCCCACCCCCCCDCCCCCACCCCCCCAmCGCCCCCCCACCCCCCCDCCCCCCCCmCCCCCCCGCCCCCCCAmCFmCCCCCDCCCCCACCCCCCCCCGCCCCCCCACCCCCCCDCCCCCCCCmCCCCCCCGCCCCCFCCCCACCCDCCCCCCACCCCCCmCCCGCCCCCCCACCCCCCCDCCCCCCCCCCmCCCCCGCCCCCCDCCCCACCCDCCCCCACCCCCFCCCGmCCCCCCCACCCCCCCDCCCCCCCCCCCCCCCGmCCCCCCCACCCCCCCDCCCCCACCCCCCCCCGmCCCCCCCACCCCCCCDCCCCCCCCmCCCCCCCGCCCCCCCAmCCCCCCCDCCCCCCCCmCCCCCCCGCCCCCCCACCCCCCDCCCCCCCCFCCCCCCCGCCCCCFCCCCACCCCDCCCCACCCmCCCACCCGCCCCCFmCACCCCCCCDCCCCCCCCCCmCCCCCGCCCCCDCCCFCACCCDCACDCACCmCACCCCCGCCCCCCCACCCCCCCDCCCCCCCCmCCCCCCCGmCCCCCCCACCCCCCCDCCCCCACCCCCCCCCGmCCCCCCCCCCCCCCCCCCCCCCCCCN Private lock Publiclanguage file_download PDF & Tabs music_note Download Midi clear ChordU Learn Any Instrument ChordU has always been about simplicity and ease of access. We are constantly improving our accuracy through research and development. We hope you have a wonderful experience with us. Hello Again !! Please login to your ChordU account. mail Login with Email Forgot Password? Don't have an account? Sign Up trending_flat clearsecurity Forgot Password No worries, enter your registered email to reset your password keyboard_backspace Back to Login
LirikDan Chord Lagu Via Vallen - Bidadari Kesleo. INTRO G Em C D G Em Untumu.. ono kawate C D Ono lomboke, ono kangkunge G Em Yen mrenges.. ketok aslimu C D Ketok wagumu.. ketok mrongosmu G Bidadari keseleo G mekso-mekso banget Em nganggo kawat abang ijo Em Pupure medok mirok
Home » Kumpulan Chord Via Vallen Via Vallen - Kejam Via Vallen feat Chevra Yolandi - Denganku Saja Via Vallen - Na Na Na Via Vallen feat. Chevra Papinka - Cintamu Terbaik Untukku Via Vallen - Ngalah Via Vallen - Pasti Untukmu Via Vallen - Kita Bisa Via Vallen feat. Dyrga Dadali - Kasih Dengarkanlah Aku Ayah - Via Vallen, Dyrga, Chevra, Ave, Jovan, Maisaka, Anita Kaif Rhoma Irama feat. Via Vallen - Cuma Kamu New Version Via Vallen feat Chevra, Dyrga, Ave, Jovan, Arthur, Maisaka - Pandemi Via Vallen - Mung Titipane Via Vallen - Dalan Liyane Via Vallen - Cinta Sejati Via Vallen - Lungset Via Vallen - Mantan Tersayang Via Vallen - Salah Apa Aku Setan Apa Yang Merasukimu Via Vallen - Bro Via Vallen - On My Way Alan Walker Koplo Version Via Vallen - Maaf Dari Anakmu Via Vallen - Ketika Via Vallen - Pamer Bojo Via Vallen - Sewu Kutho Via Vallen - Jaga dirimu Via Vallen - Selow Via Vallen - Tresnoku Kepenggak Itungan Jowo Via Vallen - Karma Via Vallen - Kangen Kowe Sayang 4 Via Vallen - Angin Kangen Via Vallen - Meraih Bintang Official Theme Song Asian Games 2018 Via Vallen - Lamis Via Vallen - Pantai Papuma Dadi Kenangan Via Vallen - Bagai Langit dan Bumi Via Vallen - Sempurnakan Langkahku Via Vallen - Jerit Atiku Via Vallen - Sayang Via Vallen - Kalah Cepet Via Vallen - Pak Polisi Via Vallen - Bojomu Turahanku Via Vallen - Cerita Anak Jalanan Via Vallen Feat. Arga Wilis - Kau Tercipta Dari Tulang Rusukku Via Vallen - Urip Dewe Via Vallen - Peternak Luka Via Vallen - Cabe Cabean Cabe Jaman Now Via Vallen - Mbukak Jaitan Via Vallen - Rasan-Rasan Tonggo Via Vallen - Nasibe Wong Ra Duwe Via Vallen - Luput Via Vallen - Cinta Kurang Gizi Via Vallen - Warna Cinta Halaman 1 dari 212»
Bidadarikeseleo mekso-mekso banget nganggo kawat abang ijo F Pupure medok mirok katon kandel separo G Dowo untune koyo sungai bengawan solo, solo C Am Bidadari kesleo ngempet" banget dadi pengen nduwe bojo F Opo mungkin samar yen ora keduman jodoh G Lan opo mungkin amung ngarep pengen mlekoto
album Simplified info_outline Major & minor chords only visibility 123 album Advanced info_outline Includes 6,7,aug,hdim7 chords visibility 123 album Bass info_outline Advance chords for bass visibility 123 album Edited info_outline All Edited versions visibility 123 album Chords Notes info_outline Notes in chords visibility 123 album Simple Notes info_outline Rhythm of the song visibility 123 album Bass Notes info_outline Sheet music of bass visibility 123 album Music Notes info_outline Sequence of instrument notes visibility 123 close aspect_ratio arrow_drop_down Show all diagrams layers Edit Lyrics cloud_done Save cancel Cancel Edit delete_forever Delete this Version 3/4Time Signature arrow_back0SHIFT arrow_forward BPM doneclose NNNNFNNNNNNNNNNNNNNNNNNNNNGNNNNNNNNNEmNNNNNNNNNCNNNNNNNNDNNNNNNNNGNNNNNNNNEmNNNNNNNNCNNNNNNNNNDNNNNNNNNGNNNNNNNNEmNNNNNNNNCNNNNNNNNNDNNNNNNNNGNNNNNNNNEmNNNNNNNNCNNNNNNNNNDNNNNNNNNGNNNNNNNNEmNNNNNNNNCNNNNNNNNNDNNNNNNNNGNNNNNNNNEmNNNNNNNNCNNNNNNNNDNNNNNNNNNGNNNNNNNNEmNNNNNNNNCNNNNNNNNDNNNNNNNNNGNNNNNNNNNEmNNNNNNNCNNNNNNNNDNNNNNNNNGNNNNNNNNNEmNNNNNNNNCNNNNNNNNDNNNNNNNNGNNNNNNNNNEmNNNNNNNNCNNNNNNNNDNNNNNNNNGNNNNNNNNNEmNNNNNNNNCNNNNNNNNDNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN Private lock Publiclanguage file_download PDF & Tabs music_note Download Midi clear ChordU Learn Any Instrument ChordU has always been about simplicity and ease of access. We are constantly improving our accuracy through research and development. We hope you have a wonderful experience with us. Hello Again !! Please login to your ChordU account. mail Login with Email Forgot Password? Don't have an account? Sign Up trending_flat clearsecurity Forgot Password No worries, enter your registered email to reset your password keyboard_backspace Back to Login
- Ойиኃобяρը врοготև
- ጶтв ሞхуфочуթ вιժαвոլዟ
. 271 413 395 240 413 178 298 65
chord via vallen bidadari kesleo